H441 cells taiwan

Author: tmvj

August undefined, 2024

WebAug 1, 2024 · We chronically exposed Ba/F3 cells transduced with KRAS G12C to sotorasib or adagrasib in the presence of N-ethyl-N-nitrosourea and ... [G12C], NCI-H2122 [G12C], A549 [G12S], NCI-H2009 [G12A], NCI-H441 [G12V], and SK-LU1 [G12D]) treated with the indicated concentrations of sotorasib or adagrasib for 72 hours. The results are revealed … WebJul 29, 2024 · A549-CR cells divide much more rapidly than H441-CR cells (Supplementary Fig. 1), discounting the possibility that higher numbers of survivors at later time points are simply due to rapid growth ...

EpCAM Signaling Promotes Tumor Progression and Protein …

WebTo investigate the mechanism of SFTPB repression, the human pulmonary epithelial cell lines NCI-H441 (H441) and NCI-H820 (H820) and the mouse macrophage-like cell line RAW264.7 were treated with LPS. Whereas LPS did not decrease SFTPB transcripts in H441 or H820 cells, the conditioned medium of LPS-treated RAW264.7 cells decreased … WebFeb 13, 2015 · Double check your media, serum % and CO2 levels. The H441s do slow down in growth if they are not treated properly, we had a similar problem from incorrect serum percentage. The slow down in ... cooler phy dokkan

NCI-H441 [H441] - CRM-HTB-174 ATCC

WebJun 6, 2016 · Treatment of pterostilbene decreased the percentage of CD133 + H441 cells co-cultured with M2 TAMs. ... (Taipei City, Taiwan) were enrolled for the study. All of the … WebFeb 13, 2015 · Double check your media, serum % and CO2 levels. The H441s do slow down in growth if they are not treated properly, we had a similar problem from incorrect … WebMar 21, 2016 · H441, 293T, and MDCK cells were used in this study (ATCC). H441 cells (a human club cell-like line) were maintained in RPMI-1640 (ATCC), MDCK cells were maintained in EMEM (Gibco), and 293T cells were maintained in DMEM (Gibco). All media was supplemented with 10% (vol/vol) FCS, L-glutamine, and Pen/Strep. Development of … cooler pichau

EpCAM Signaling Promotes Tumor Progression and Protein …

NCI-H441 Transfection Kit (Lung Carcinoma) - Altogen

WebNov 10, 2024 · For experiments on transwell, the cells were exposed generally 15 days post cell seeding (12 days post ALI) when NCI-H441 cells had formed functional epithelial barriers, as evidenced by a TEER ... WebDec 9, 2024 · The results demonstrated that p-AMPK protein levels were upregulated in FH knockdown CL1-0 and H441 cells by 2- and 1.5-fold, respectively, compared with the control shluc ... E-Da Hospital, Kaohsiung, Taiwan) recruited some patients in this study; he was an original member of the research team but was deceased before the submission … cooler phoenixcomWebH441 cells were cultured on glass coverslips before being transfected, as mentioned previously. After incubation, cells were fixed for 15 min at 4 °C with 4% formaldehyde, permeabilized for 5 min with 0.01% Triton X-100 and blocked for 30 min at room temperature with 1% bovine serum albumin. family names in romeo and juliet

"WebAug 9, 2024 · NSCLC H1299 and H441 cells were infected with JARID1B small hairpin RNA (shRNA, Clone ID: TRCN0000329952, target sequence: ATCGCTTGCTTCATCGATATT … " - H441 cells taiwan

H441 cells taiwan

Nutrients Free Full-Text Astragalus polysaccharides (PG2 ... - MDPI

WebOct 10, 2012 · A549 and H441 cells were used to evaluate the effects of HO-1 expression on NSCLC cell migratory and metastatic abilities in vitro. First, A549 and H441 cells were transfected with a HO-1 expression vector to induce exogenous HO-1 expression. The resulting HO-1 over-expression was significant (20x) and confirmed by real-time PCR … WebNov 15, 2013 · Acrolein, an α,β unsaturated electrophile, is an environmental pollutant released in ambient air from diesel exhausts and cooking oils. This study examines the role of acrolein in altering mitochondrial function and metabolism in lung-specific cells. RLE-6TN, H441, and primary alveolar type II (pAT2) cells were exposed to acrolein for 4 h, and its …

Did you know?

WebAug 10, 2024 · Lung cancer is one of the most common malignancies in Taiwan and remains the leading cause of cancer-related death globally, with more than 1.3 ... For the conditioned medium experiments, CL1-0 and H441 cells were pretreated with the conditioned medium (CM) from IMPAD1-overexpressing or IMPAD1-knockdowned CL1 … WebCRM-HTB-174 ™. NCI-H441 [H441] is an epithelial-like cell that was isolated from the lung of a male with papillary adenocarcinoma. The cell line can be used in testing and …

WebFeb 5, 2010 · Abstract Toona sinensis is a traditional Chinese herb, and the extracts of T. sinensis leaf possess a variety of biological functions. This study attempted to test the antiproliferative effect of TSL-1 (a bioactive fraction of T. sinensis) in H441 cells (lung adenocarcinoma). The data showed that the antiproliferative effect of TSL-1 on H441 … WebOct 25, 2016 · We performed functional and phenotypic characterisation of ion transport in the human pulmonary epithelial cell lines NCI-H441 and A549 to determine their …

Web1 Department of Pharmacology, Kaohsiung Medical University, Kaohsiung, Taiwan. PMID: 22230399 ... Human H441 cells were grown in hypoxia for 24-72 h. KMUP-1 (1, 10, 100 microM) arrested cells at the G0/G1 phase of the cell cycle, reduced cell survival and migration, increased p21/p27, restored eNOS, increased soluble guanylate cyclase … WebMay 4, 2016 · A wound healing assay was set up on NCI-H441 cells, with or without HGF and the antibodies to be tested, using the Oris TM Universal Cell Migration Assembly Kit (Tebu-Bio, FR) as per the manufacturer's recommendations. Invasion assay. A549 cells (5 × 10 5) were plated in the upper well of BD BioCoat™ Matrigel invasion chambers. The …

WebNCI-H441 Cell Line: NCI-H441 is a human non-small cell lung cancer cell line that was originally derived from a patient with lung adenocarcinoma. NCI-H441 cells are characterized by their high expression of mucin proteins, which are involved in the production of mucus in the lungs. These cells also have a mutation in the TP53 gene, …

WebOct 25, 2016 · Robust and reproducible in vitro models are required for investigating the pathways involved in fluid homeostasis in the human alveolar epithelium. We performed … cooler pfpWebNov 13, 2024 · A, H441 cells were treated with TAPI (ADAM17 inhibitor) or DAPT (γ-secretase inhibitor) for 24 hours, and PD-L1 expression was analyzed by Western ... We … cooler pickup sleepers family name sladeWebNov 16, 2024 · Human pulmonary carcinoma H441, A549, H1299 cells and bronchial epithelial 16HBE cells were purchased from China Center for Type Culture Collection, China. The cells were cultured in RPMI-1640 or DMEM medium supplemented with 10% fetal bovine serum (Gibco, USA), 100 U/mL penicillin and 100 μg/mL streptomycin … cooler pick washerWebMar 3, 2014 · The cell line NCl-H441 is a useful in vitro model for transport studies of human distal lung epithelial barrier. The lack of a well characterized, continuously … cooler pickup tubeWebMar 17, 2024 · The Cas9 RNP solution was mixed with 2 × 10 5 NCI-H441 cells, 2 × 10 5 CFPAC-1 cells, or 1 × 10 6 RPMI-6666 cells in 20 μL of Opti-MEM (Thermo Fisher Scientific) in a 0.1-cm cuvette (Bio-Rad). The cuvettes were electroporated at 150 V for 10 ms (NCI-H441 and CFPAC-1) or 100 V for 10 ms (RPMI-6666) using the BTX ECM 2001 … family names in spainWebH441 cells were used as a representative epithelial cell line to examine the role ofsGC and VEGF in hypoxia and the anti-proinflammatoryactivity of KMUP-lin normoxia. ... 100 Shih-Chuan I" Road, Kaohsiung 807, Taiwan Fax: ++886 7 3234686 e-mail: ingjun @kmu.edu.tw 0394-6320 (20II) cooler picnic basket with wooden lid